PROGNOSTIC SIGNIFICANCE OF HEPATOCYTE GROWTH FACTOR IN NON-METASTATIC COLORECTAL CANCER

Full Text

Introduction.
The hepatocyte growth factor (HGF)/c-MET receptor axis is involved in signaling in basic biological processes such as stimulation of epithelial cell movement, three-dimensional morphogenesis and regulation of apoptosis [1]. Recent studies have shown that aberrant HGF/c-MET signaling can lead to uncontrolled proliferation of tumor cells, their increased mobility, invasion and angiogenesis, playing a significant role in the development of cancer, including gastric cancer [2], breast cancer [ 3], colorectal cancer [4].
HGF is produced by mesenchymal cells and is a ligand for the tyrosine kinase receptor c-MET, acting as a cytokine on cells of epithelial origin, stimulating mitogenesis and angiogenesis [5].
Hepatocyte growth factor is found in many organs, including breast, lung, kidney and liver. There is ambiguous information that tumor cells of some solid tumors, in particular pancreatic adenocarcinoma cells, unlike stromal stellate cells of the gland, do not secrete HGF [6]. In tumor cells, HGF has been shown to play an important role in proliferation and angiogenesis and promotes tumor cell growth, infiltration into surrounding tissues, and metastasis [7].
At the same time, the literature provides data confirming that higher expression of both HGF and its receptor c-MET was associated with a better prognosis [8].

Colorectal cancer is one of the most common tumors in both men and women and the second leading cause of cancer mortality worldwide [9]. The modern approach to treatment involves the use of various chemotherapy regimens, targeted or immunotherapy, depending on the clinical situation and molecular genetic subtype of the tumor. The mechanisms of tumor resistance to therapy are not fully understood. One of the reasons for resistance to antiangiogenic therapy may be a switch to an alternative path of angiogenesis - the formation of vessels from previous ones, intussusception, vasculogenesis, vascular mimicry, differentiation of tumor cells into endothelial cells, tumor growth along the vessels, including switching from VEGF-A to an alternative proangiogenic factor. Hypoxia, on the one hand, leads to clonal selection of tumor cells with high invasive potential [10]. On the other hand, hypoxia activates an invasive growth program driven by HGF. The latter allows tumor cells to avoid the effects of antiangiogenic therapy [11].

Purpose of the study.
Assessing the prognostic significance of HGF expression in tumor tissue in non-metastatic colorectal cancer (CRC).

Materials and methods.

The retrospective study was carried out at the research medical and biological center of Ulyanovsk State University (UlSU). As biomaterial, histological sections of tumors containing at least 80% of tumor cells and sections from blocks of resection lines of the same tumor samples obtained intraoperatively from patients with colorectal cancer who received treatment on the basis of the Regional Clinical Oncology Dispensary of Ulyanovsk during the period from 2014 were used to 2020 The study protocol was approved by the ethics committee of the Institute of Medicine, Ecology and Physical Culture of Ulyanovsk State University (No. 9 of September 15, 2014). The clinical trial included 50 patients with non-metastatic colorectal cancer. The characteristics of clinical observations are presented in Table 1.

Patients were examined every 2 months. chemotherapy (CT) and after its completion. At the same time, a general clinical, biochemical blood test, general urine test, blood for cancer embryonic antigen (CEA), CA 19/9 were assessed. Instrumental examination methods were carried out: radiography of the chest organs in two projections, ultrasound of the abdominal organs, pelvis, retroperitoneum, fibrocolonoscopy (if indicated). In case of doubtful results of standard examination methods, multislice computed tomography or magnetic resonance imaging of the chest, abdominal cavity, and pelvis with intravenous contrast was performed. At the end of treatment, patients were under the dynamic supervision of an oncologist, with periodic control examinations in accordance with clinical recommendations.

FFPE tumor samples were used for expression analysis in the study. RNA isolation from paraffin blocks (FFPE) was carried out from tumor sections 10-15 µm thick (total area of at least 2 cm2) using SileksMagNA magnetic particles (KIRFFPE0100 kit, Silex LLC, Moscow, Russia) according to the manufacturer’s protocol. Immediately after DNA extraction, a reverse transcription (RT) reaction was performed. To obtain RNA from DNA on a template, a random hexanucleotide primer and components of the MMLVRT Kit (EvrogenLab LLC, Moscow) were used. Quantitative real-time PCR was then performed using the intercalating dye Sybr. Primers for PCR specific to HGF1 (Forward: GTAAATGGGATTCCAACACGAACA Reverse: TGTCGTGCAGTAAGAACCCAACTC) were synthesized on the basis of EvrogenLab LLC (Moscow, Russia). The GAPDH gene was used as a referee (house-keeping) gene. The reaction mixture for PCR contained 5 μl of PCRmix (set “Ready mix for PCR qPCRmix-HSSYBR”), a mixture of forward and reverse primers in a final concentration of 0.4 μM, 5-8 μl of DNA (50 ng per reaction), sterile water in the volume required up to 25 µl reaction. PCR was carried out in triplets on a CFX-96 BioRad (USA) thermal cycler. Calculation of normalized expression of the studied gene relative to the reference gene was carried out using CFX Manager software from Bio-Rad Laboratories.

Statistical data processing was performed using STATISTICA 13.0 software (StatSoft, USA), BioStat v.7.1., Jamovi 1.6.8. The study is aimed at studying a new marker and is exploratory in nature. Comparison of characteristics in the case of non-normal distribution was carried out using the nonparametric Mann-Whitney U test. Cox and Kaplan-Meier linear regression tests were used to analyze progression-free survival. When discussing the results, we used our previously obtained data on the level of expression of TGFβ and CXCL8 in the tumor tissue of patients with CRC [12].

Research results.
As a result of the studies, it was established that in 60% of the studied tumor samples the studied marker was not expressed; in other cases, the level of HGF mRNA in the tumor in patients with colorectal cancer did not depend on age, did not differ significantly at stages II and III of the disease, but was significant
higher than in resection line specimens.

When a tumor has a BRAF mutation in the EGFR signaling pathway, the level of HGF mRNA is significantly higher than that in wild-type tumors and in tumor tissue with NRAS and KRAS mutations. Pronounced differences in the level of HGF mRNA were detected in poorly differentiated primary tumors compared with moderately and highly differentiated tumors (Table 2).

We previously established dependent overexpression of transforming growth factor TGFb and interleukin-8 (CXCL8), which characterize a certain phenotype of CRC tumors with high metastatic potential [12]. In a multivariate version of Cox regression, it was found that dependent prognostic factors in the occurrence of relapse in patients with stages II-III CRC are right-sided localization, an increase in the blood level of CEA (HR 23.04 CI95%1.95-272.74, p = 0.013) , increased coexpression of HGF (HR 0.64 CI95% 0.42-0.98, p=0.039), TGFβ (HR 0.17 CI95% 0.04-0.72, p=0.017), CXCL8 (HR 3, 51 CI95%1.16-10.56, p=0.026) in the primary tumor (p<0.05).

Kaplan-Meier analysis of disease-free survival in CRC patients according to the level of HGF expression (predicted level by proportional hazards assessment - 0.7) showed that the median survival was 1 (HGF expression more than 0.7) and 2 (HGF expression less than 0.7 ) groups was 23.3 and 62.9 months, respectively (long-rank test p = 0.215) (Fig. 1).

Discussion.
Today, the presence of mutations in the KRAS, NRAS, and BRAF genes is used as prognostic factors for colorectal cancer. It has been shown that KRAS gene mutations occur in 30-50% of CRC cases [13]. Today it has been established that KRAS mutations worsen the prognosis of cancer of the right half of the colon. However, no statistically significant dependence of disease progression on KRAS status was identified [14]. We found lower levels of HGF mRNA in tumors with a KRAS mutation.

The BRAF oncogene plays an important role in the mitogen-activated proteinase signaling pathway. About 10% of patients with CRC have a BRAF gene mutation, which determines increased cell proliferation and, accordingly, tumor growth [15]. In our studies, we determined that in tumors with a BRAF mutation in the EGFR signaling pathway, the level of HGF mRNA is significantly higher than that in “wild type” tumors and tumor tissue with NRAS and KRAS mutations. This dramatic activation of the HGF/c-MET signaling pathway makes it possible to get closer to deciphering the mechanisms that determine, in this case, the high aggressiveness of the tumor.

Conclusion.
Using the level of HGF expression in the tumor tissue of patients with non-metastatic colorectal cancer before treatment to assess the prognosis of the relapse-free period is only possible in conjunction with the expression of TGFβ, CXCL8 in the tissue and the level of CEA in the blood of these patients.

About the authors

Irina A. Bogomolova

FSBI "Federal Scientific Clinical Centre for Medical Radiology and Oncology" of FMBA of Russia

Email: 73bogomolova@gmail.com
ORCID iD: 0000-0003-3331-8632
SPIN-code: 7873-1172
Scopus Author ID: 57473985700

Head of the department of antitumor drug therapy of the hospital, FSBI «Federal Scientific Clinical Center for Medical Radiology and Oncology» of FMBA of Russia

Russian Federation, 433507, Россия, Димитровград, ул.Курчатова,5В

Dinara R. Dolgova

Ulyanovsk State University

Email: dolgova.dinara@yandex.ru
ORCID iD: 0000-0001-5475-7031
Scopus Author ID: 55378365200

Ph.D., Associate Professor, Department of Physiology and Pathophysiology, Medical Faculty, Ulyanovsk

Russian Federation, 432017,Россия,Ульяновск, ул. Арх. Ливчака,2

Inna I. Antoneeva

Ulyanovsk State University;
Regional Clinical Oncology Center of Ulyanovsk

Email: aii72@mail.ru
ORCID iD: 0000-0002-1525-2070
Scopus Author ID: 6504605612

PhD, MD (Medicine), Associate Professor, Professor, Department of Oncology and Radiology; Head, Department of Oncogynecology

 

 

Russian Federation, 432017, Россия, Ульяновск, ул. Архитектора Ливчака, 2

Tatyana V. Abakumova

Ulyanovsk State University

Email: taty-abakumova@yandex.ru
ORCID iD: 0000-0001-7559-5246
Scopus Author ID: 37103623900

Abakumova Tatyana V. - PhD (Biology), Associate Professor, Department of Physiology and Pathophysiology

Russian Federation, 432017, Россия, Ульяновск, ул. Архитектора Ливчака, 2

Tatyana P. Gening

Ulyanovsk State University

Email: Naum-53@yandex.ru
ORCID iD: 0000-0002-5117-1382
Scopus Author ID: 6507217338

PhD, MD (Biology), Professor, Head, Department of Physiology and Pathophysiology

Russian Federation, 432017, Россия, Ульяновск, ул. Архитектора Ливчака, 2

Yuri D. Udalov

FSBI "Federal Scientific Clinical Centre for Medical Radiology and Oncology" of FMBA of Russia

Author for correspondence.
Email: info@fnkcrio.ru
ORCID iD: 0000-0001-6790-4248
Scopus Author ID: 57194193916

Doctor of medical sciences, Associate Professor, external expert of the FMBA of Russia in medical radiology, general manager of FSBI «Federal Scientific Clinical Center for Medical Radiology and Oncology» of FMBA of Russia

Russian Federation, 433507, Россия, Димитровград, ул.Курчатова,5В

References

Supplementary files